View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19643_low_8 (Length: 275)
Name: NF19643_low_8
Description: NF19643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19643_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 20 - 259
Target Start/End: Complemental strand, 26914994 - 26914754
Alignment:
| Q |
20 |
cttggggcttggggccaacgcacatttttattgtcttattatatgtagattatcttatctacactaaaatcaatatgaagatgaaaaatgaactaaaaaa |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914994 |
cttggggcttgtggccaacgcacatttttattgtcttattatatgtagattatcttatctacactaaaatcaatatgaagatgaaaaatgaactaaaaaa |
26914895 |
T |
 |
| Q |
120 |
gacatttgatatgaccatcttttgtcgtgatttactacttcctcgacatataagtgaac-nnnnnnnnttatttcacgaaagaaatgcacataaacacta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26914894 |
gacatttgatatgaccatcttttgtcgtgatttactacttcctcgacatataagtgaacaaaaaaaaattatttcacgaaagaaatgcacataaacacta |
26914795 |
T |
 |
| Q |
219 |
ctnnnnnnncttaataagtatgatttcgatccatttgttac |
259 |
Q |
| |
|
|| |||| | |||||||||||||||||||||||| |
|
|
| T |
26914794 |
ctaaaaaaatttaagatgtatgatttcgatccatttgttac |
26914754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University