View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19644_low_14 (Length: 211)
Name: NF19644_low_14
Description: NF19644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19644_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 4871443 - 4871258
Alignment:
| Q |
1 |
taatttgcgagaacctaaattggagtttcattctatttatttgatgcatttccactatgtggaagcatatcaaataagtgctcgtagaccatactaaatt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4871443 |
taatttgcgggaacctaaattggagttttattctatttatttgatgcatttccactatgtggaagcatatcaaataagtgctcgtagaccatactaaact |
4871344 |
T |
|
| Q |
101 |
ttcctctgaattgttgttgtagggaagtggaagataaggcctctaagtaattagatgaatgataagaggtttgccaattgagttttatc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4871343 |
ttcctctgaattgttgttgtagggaagtggaagataaggcctctaagta---agatgaatgataagaggtttgccaattgagttttatc |
4871258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University