View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19644_low_5 (Length: 389)
Name: NF19644_low_5
Description: NF19644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19644_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 9e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 4871490 - 4871592
Alignment:
| Q |
1 |
tgatcatataatatttgatttttacaaaatgtattaatgttattatcaaacaacggttataaaaaagtgacccatagcctgatctaaacggtttttacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4871490 |
tgatcatataatatttgatttttacaaaatgtattaatgttattatcaaacaacggttataaaaaagtgacccatagcctgatccaaacggtttttacaa |
4871589 |
T |
|
| Q |
101 |
aaa |
103 |
Q |
| |
|
||| |
|
|
| T |
4871590 |
aaa |
4871592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 230 - 375
Target Start/End: Original strand, 4871721 - 4871869
Alignment:
| Q |
230 |
gtaaagaccgcaacaagggttcatctttgtgttgaatttcaagttagggcagannnnnnnnnnnnnnnncagaactagggttcatcttctttctcactat |
329 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4871721 |
gtaaagaccgcaacaagggttcctctttgtgttgaatttcaagttagggcagattttatttttgtttttcagaactagggttcatcttctttctcactat |
4871820 |
T |
|
| Q |
330 |
cacgaa---gcaacaatgctctcaatgttaagaagaagatgtgttggtg |
375 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4871821 |
cacgaattagcaacaatgctctcaatgttaagaagaagatgtgttggtg |
4871869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University