View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19645_high_21 (Length: 314)

Name: NF19645_high_21
Description: NF19645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19645_high_21
NF19645_high_21
[»] chr8 (3 HSPs)
chr8 (1-312)||(14759196-14759507)
chr8 (1-312)||(26972741-26973052)
chr8 (195-307)||(23133137-23133249)
[»] chr4 (3 HSPs)
chr4 (55-312)||(54477958-54478208)
chr4 (234-307)||(46785030-46785103)
chr4 (222-301)||(14307291-14307370)
[»] chr2 (9 HSPs)
chr2 (191-307)||(16321925-16322041)
chr2 (236-312)||(26790842-26790918)
chr2 (231-312)||(19264932-19265013)
chr2 (195-307)||(14654232-14654344)
chr2 (231-312)||(40327694-40327775)
chr2 (252-310)||(177030-177088)
chr2 (234-312)||(39012049-39012127)
chr2 (231-312)||(35135769-35135850)
chr2 (231-307)||(42403772-42403848)
[»] scaffold0036 (1 HSPs)
scaffold0036 (1-268)||(68144-68411)
[»] scaffold0214 (1 HSPs)
scaffold0214 (234-312)||(8486-8564)
[»] chr7 (3 HSPs)
chr7 (201-312)||(16770514-16770625)
chr7 (198-310)||(23208421-23208533)
chr7 (234-312)||(1579712-1579790)
[»] chr3 (7 HSPs)
chr3 (195-304)||(26433253-26433362)
chr3 (234-312)||(17718908-17718986)
chr3 (234-312)||(19020137-19020215)
chr3 (234-312)||(3660165-3660243)
chr3 (198-312)||(38647732-38647846)
chr3 (195-307)||(11896631-11896743)
chr3 (234-311)||(24730901-24730978)
[»] chr1 (4 HSPs)
chr1 (195-307)||(20284332-20284444)
chr1 (199-312)||(43297845-43297958)
chr1 (220-312)||(5193604-5193696)
chr1 (198-312)||(1524453-1524567)
[»] chr5 (4 HSPs)
chr5 (234-312)||(23944537-23944615)
chr5 (252-312)||(23621171-23621231)
chr5 (243-312)||(6641566-6641635)
chr5 (191-307)||(7813303-7813419)
[»] chr6 (2 HSPs)
chr6 (234-312)||(24894389-24894467)
chr6 (198-312)||(35232972-35233086)


Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 14759196 - 14759507
Alignment:
1 gaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattattttaaagc 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||||||| |||||    
14759196 gaagaaagaaaaatcgggtccataggctgcaactcccttgtggtacatggtcatatgatagtgacactctccaagaagaagcacaaaattatttcaaagc 14759295  T
101 tttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactctctccaatc 200  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14759296 tttcttcagtggtatcgaacctaaccatgacagaaatttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactctctccaatc 14759395  T
201 accaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcata 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||    
14759396 accaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggctttcactacatcttttttaaacaatcctggcata 14759495  T
301 ttgttggagatg 312  Q
    | ||||||||||    
14759496 tagttggagatg 14759507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 26972741 - 26973052
Alignment:
1 gaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattattttaaagc 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||||||| |||||    
26972741 gaagaaagaaaaatcggatccataggcttcaactcccttgtggtacatggtcatatgatagtgacactctccaagaagaagcacaaaattatttcaaagc 26972840  T
101 tttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactctctccaatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||    
26972841 tttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgaagattggaagctctctttactctctccaatc 26972940  T
201 accaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcata 300  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
26972941 accaaaagagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggctttcactgcatcttttttaaacaatactggcata 26973040  T
301 ttgttggagatg 312  Q
    | ||||||||||    
26973041 tagttggagatg 26973052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 307
Target Start/End: Complemental strand, 23133249 - 23133137
Alignment:
195 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 294  Q
    |||||||||||||| || || | | |||| ||||| || ||||| ||||||||||||||||| || |||||||| || |||||||| || || || ||||    
23133249 ccaatcaccaaaaatgaagtttatgctgcccttaactccatgaaaccctacaaagcccctggtccggatggtttccattgcatcttcttcaagcagtact 23133150  T
295 ggcatattgttgg 307  Q
    |||| ||||||||    
23133149 ggcacattgttgg 23133137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 55 - 312
Target Start/End: Complemental strand, 54478208 - 54477958
Alignment:
55 atgatagtgacaccctccaagaagaagcacaaaattattttaaagctttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatcca 154  Q
    ||||||||||||| |||||||||||||| ||||||||||| ||  |||||||| |||| | | |||| ||||||||| |||| |||||||  || || ||    
54478208 atgatagtgacactctccaagaagaagctcaaaattatttcaagactttcttcggtggcaaccaaccaaaccatgaccgaagcttcaatgttggtattca 54478109  T
155 ccctaccatagatgacgatgggaagctctctttactctctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccct 254  Q
    ||||  ||       ||| || ||||| ||||||  ||| |||||||||||||||||||| ||| || | ||||| |||||||||||||| |||||| |     
54478108 cccttaca-------cgagggtaagctttctttaacctccccaatcaccaaaaaagaggtgtttgcttcccttaactctatgaagccctataaagcctca 54478016  T
255 ggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||| ||||| || |||| |||||| || |||||||| ||||| |||||||| ||||    
54478015 ggcccagatggcttccactacatcttcttcaaacaatattggcacattgttggtgatg 54477958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 234 - 307
Target Start/End: Complemental strand, 46785103 - 46785030
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttgg 307  Q
    ||||| ||||||||| | ||||| || |||||||| || |||||||| || |||||||||||||| ||||||||    
46785103 atgaaaccctacaaatctcctggtccggatggtttccaatgcatcttcttcaaacaatactggcacattgttgg 46785030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 222 - 301
Target Start/End: Original strand, 14307291 - 14307370
Alignment:
222 gctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatat 301  Q
    ||||| || |||||||| || |||||| || ||||||| ||||||||||| ||||| || || |||||||| ||||||||    
14307291 gctctgaactctatgaaaccttacaaatcctctggcccagatggttttcaatgcattttcttcaaacaatattggcatat 14307370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 307
Target Start/End: Original strand, 16321925 - 16322041
Alignment:
191 ctctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaa 290  Q
    |||||| || |||||||||||||| ||| |||| || || || ||||| ||||||||||| ||||| |||||||| ||||| ||||| || |||||||||    
16321925 ctctcctattaccaaaaaagaggtttttgctgccctcaactccatgaaaccctacaaagcacctggtcccgatggctttcattgcattttctttaaacaa 16322024  T
291 tactggcatattgttgg 307  Q
    |||||||| ||||||||    
16322025 tactggcacattgttgg 16322041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 236 - 312
Target Start/End: Original strand, 26790842 - 26790918
Alignment:
236 gaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    |||||||||||||||||||||||||||||||||||| || || |||||||||||||| | ||| |||||||| ||||    
26790842 gaagccctacaaagcccctggccccgatggttttcattgtattttttttaaacaatattcgcacattgttggtgatg 26790918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 231 - 312
Target Start/End: Original strand, 19264932 - 19265013
Alignment:
231 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||||||||| |||||||||||||| || ||||| ||||| ||||| || || |||||||||||||| ||||| |||||||    
19264932 tctatgaagccatacaaagcccctggtcctgatgggtttcattgcattttcttcaaacaatactggcacattgtcggagatg 19265013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 307
Target Start/End: Complemental strand, 14654344 - 14654232
Alignment:
195 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 294  Q
    |||||||||||||| || || | | |||| ||||| || ||||||||||||||||||||||| || |||||||| || |||||||| || || || ||||    
14654344 ccaatcaccaaaaatgaagtttatgctgcccttaactccatgaagccctacaaagcccctggtccagatggtttccattgcatcttcttcaagcagtact 14654245  T
295 ggcatattgttgg 307  Q
     ||||||| ||||    
14654244 agcatattattgg 14654232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 312
Target Start/End: Original strand, 40327694 - 40327775
Alignment:
231 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||||||||| |||||||||||||| || || || ||||| ||||| || || |||||||||||||| ||||| |||||||    
40327694 tctatgaagccttacaaagcccctggtcctgacgggtttcattgcattttcttcaaacaatactggcacattgtcggagatg 40327775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 310
Target Start/End: Original strand, 177030 - 177088
Alignment:
252 cctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggaga 310  Q
    |||||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| ||||    
177030 cctggcccagatggttttcaatgcatctttttcaaacaatattggcacattgttagaga 177088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 312
Target Start/End: Original strand, 39012049 - 39012127
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||| ||||||||||||||||| || ||||| || || ||||| |||||||| ||||| ||||| ||| |||||||||    
39012049 atgaaaccctacaaagcccctggaccagatggcttccaatgcatattttttaagcaatattggcacattattggagatg 39012127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 231 - 312
Target Start/End: Complemental strand, 35135850 - 35135769
Alignment:
231 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||||||||| |||||||||||||| || || || ||||| ||||| || || || ||||||||||| ||||| |||||||    
35135850 tctatgaagccatacaaagcccctggtcctgacgggtttcattgcattttcttcaagcaatactggcacattgtcggagatg 35135769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 307
Target Start/End: Complemental strand, 42403848 - 42403772
Alignment:
231 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttgg 307  Q
    ||||||||||| ||||| || ||||| || |||||||| || |||||||| || |||||||| ||||| ||||||||    
42403848 tctatgaagccttacaaggcacctggtcctgatggtttccattgcatcttcttcaaacaatattggcacattgttgg 42403772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 68144 - 68411
Alignment:
1 gaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattattttaaagc 100  Q
    ||||||| | |||| | |||||||| || ||||||||||||||||| |||||   |||||| ||||  || ||||| || || ||||| ||||| ||       
68144 gaagaaaaagaaatagaatccatagacttcaactcccttgtggtacttggtcctctgatagcgacattcttcaagaggaggcccaaaactatttcaagaa 68243  T
101 tttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactctctccaatc 200  Q
    |||||||||||| | | |||||||||||||  ||  |||||||||||||   |||||| |||| |||| |||||||||  | ||||||   |||||||||    
68244 tttcttcagtggcaaccaacctaaccatgatcgatctttcaatgaaggcgctcacccttccattgatgccgatgggaaaatttctttaacttctccaatc 68343  T
201 accaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttt 268  Q
    ||||||   || || ||  |||| |||||  |||| |||||| ||||||||||||||||| |||||||    
68344 accaaacctgaagtgttcgctgcccttaaccctataaagcccaacaaagcccctggccccaatggttt 68411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0214
Description:

Target: scaffold0214; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 234 - 312
Target Start/End: Original strand, 8486 - 8564
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    |||||||||||||||||||||||||| ||||||||||| || || || ||||||||||  ||||| |||||||||||||    
8486 atgaagccctacaaagcccctggccctgatggttttcattgtattttctttaaacaattttggcacattgttggagatg 8564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 201 - 312
Target Start/End: Complemental strand, 16770625 - 16770514
Alignment:
201 accaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcata 300  Q
    ||||||||||| ||| || |||| ||||| |||||||| || |||||||| || || || |||||||| || ||||| ||||| |||||||||||||| |    
16770625 accaaaaaagaagtccttgctgcccttaactctatgaaaccttacaaagcaccaggtccggatggtttccaatgcatttttttcaaacaatactggcaca 16770526  T
301 ttgttggagatg 312  Q
    || |||||||||    
16770525 ttattggagatg 16770514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 198 - 310
Target Start/End: Complemental strand, 23208533 - 23208421
Alignment:
198 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 297  Q
    ||||||||||| || || |||  ||| || ||||| ||||| || ||||||||||||||||| || || || || || ||||| || |||||||| ||||    
23208533 atcaccaaaaatgaagtttttgttgccctcaattccatgaaaccatacaaagcccctggcccggacggcttccattgtatcttcttcaaacaatattggc 23208434  T
298 atattgttggaga 310  Q
    |||| ||||||||    
23208433 atatagttggaga 23208421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 312
Target Start/End: Complemental strand, 1579790 - 1579712
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||| |||||||||||||||||  | ||||  ||||| || ||||| |||||| |||| ||||| |||||||||||||    
1579790 atgaaaccctacaaagcccctggttcggatgagtttcaatgtatcttctttaaaaaatattggcacattgttggagatg 1579712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 195 - 304
Target Start/End: Complemental strand, 26433362 - 26433253
Alignment:
195 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 294  Q
    |||||||| ||||| || || | | |||| ||||| || |||||||| |||||||||||||| || |||||||| || |||||||| || ||||| ||||    
26433362 ccaatcactaaaaatgaagtttatgctgcccttaactccatgaagccttacaaagcccctggtcctgatggtttccattgcatcttcttcaaacagtact 26433263  T
295 ggcatattgt 304  Q
    ||||||||||    
26433262 ggcatattgt 26433253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 234 - 312
Target Start/End: Complemental strand, 17718986 - 17718908
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    |||||||| ||||||||||| || || ||||||||||| || |||||||| ||||| |||||||| || ||||||||||    
17718986 atgaagccgtacaaagcccccggtccagatggttttcaatgtatctttttcaaacagtactggcacatagttggagatg 17718908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 234 - 312
Target Start/End: Complemental strand, 19020215 - 19020137
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    |||||||| ||||||||||| || || ||||||||||| || |||||||| ||||| |||||||| || ||||||||||    
19020215 atgaagccgtacaaagcccccggtccagatggttttcaatgtatctttttcaaacagtactggcacatagttggagatg 19020137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 312
Target Start/End: Complemental strand, 3660243 - 3660165
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||| ||||||||||||||||| || ||||| || || ||||| |||||||| ||||| ||||| ||| |||||||||    
3660243 atgaaaccctacaaagcccctggaccagatggcttccaatgcatattttttaagcaatattggcacattattggagatg 3660165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 198 - 312
Target Start/End: Complemental strand, 38647846 - 38647732
Alignment:
198 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 297  Q
    ||||||||||| ||||| ||| |||| ||||| || ||||| || |||||||| || ||||| |||||||| || || ||||| || |||||||| ||||    
38647846 atcaccaaaaatgaggtgtttgctgcacttaactccatgaaaccttacaaagcacccggcccagatggtttccattgtatcttcttcaaacaatattggc 38647747  T
298 atattgttggagatg 312  Q
    | || || |||||||    
38647746 acatagtcggagatg 38647732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 307
Target Start/End: Original strand, 11896631 - 11896743
Alignment:
195 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 294  Q
    |||||||||||||| || || | |  ||| ||||| || ||||| ||||||||||||||||| || |||||||| || |||||||| || || || ||||    
11896631 ccaatcaccaaaaatgaagtttatgttgcccttaactccatgaaaccctacaaagcccctggtccggatggtttccattgcatcttcttcaagcagtact 11896730  T
295 ggcatattgttgg 307  Q
    | || ||||||||    
11896731 gacacattgttgg 11896743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 311
Target Start/End: Original strand, 24730901 - 24730978
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagat 311  Q
    ||||| || ||||||||||| || ||  |||| || || ||||| |||||||||||||| ||||| ||||||||||||    
24730901 atgaaaccttacaaagccccgggtccatatggcttccaatgcatattttttaaacaatattggcacattgttggagat 24730978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 307
Target Start/End: Original strand, 20284332 - 20284444
Alignment:
195 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 294  Q
    |||||||||||||| || || | | |||| ||||| || ||||| ||||||||||||||||| || |||||||| || |||||||| || || || ||||    
20284332 ccaatcaccaaaaatgaagtttatgctgcccttaactccatgaaaccctacaaagcccctggtccggatggtttccattgcatcttcttcaagcagtact 20284431  T
295 ggcatattgttgg 307  Q
    |||| ||||||||    
20284432 ggcacattgttgg 20284444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 199 - 312
Target Start/End: Original strand, 43297845 - 43297958
Alignment:
199 tcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggca 298  Q
    |||||||||| || || ||||| || ||||| || ||||| ||||||||||| || | ||| ||||| || || |||||||| || |||||||| |||||    
43297845 tcaccaaaaatgatgtgtttaccgcccttaactccatgaaaccctacaaagcacccgaccctgatggcttccattgcatcttcttcaaacaatattggca 43297944  T
299 tattgttggagatg 312  Q
     || ||||||||||    
43297945 catagttggagatg 43297958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 312
Target Start/End: Complemental strand, 5193696 - 5193604
Alignment:
220 ctgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    |||| |||||||| ||||| || |||||||| || | ||||||||  || || |||||||| ||||||||||| ||||| || ||||||||||    
5193696 ctgcccttaattccatgaaaccatacaaagcacccgaccccgatgacttccattgcatcttctttaaacaatattggcacatagttggagatg 5193604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 198 - 312
Target Start/End: Original strand, 1524453 - 1524567
Alignment:
198 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 297  Q
    ||||||||||  || ||||| | ||| ||||| || || || || |||||||| || | ||| ||||||||||| |||||||| || ||  |||||||||    
1524453 atcaccaaaaccgaagtcttcaatgcccttaactccataaaaccttacaaagcacccgaccctgatggttttcaatgcatcttcttcaagaaatactggc 1524552  T
298 atattgttggagatg 312  Q
    |||| ||||||||||    
1524553 atatagttggagatg 1524567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 234 - 312
Target Start/End: Original strand, 23944537 - 23944615
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||| |||| ||||||||||||||| ||||||||||| || ||||| || || |||||||| || |||||||||||||    
23944537 atgaaacccttcaaagcccctggcccagatggttttcaatgtatcttcttcaagcaatactgacacattgttggagatg 23944615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 252 - 312
Target Start/End: Complemental strand, 23621231 - 23621171
Alignment:
252 cctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    |||||||| ||||| || || |||||||||||||||||||| |||||||||||||| ||||    
23621231 cctggcccagatggcttccattgcatcttttttaaacaatattggcatattgttggtgatg 23621171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 6641635 - 6641566
Alignment:
243 tacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||||||||||||||| ||||||||||||||||  || || | |||||||||||| | |||||| ||||    
6641635 tacaaagcccctggccctgatggttttcactgcaatttcttcatacaatactggcacaatgttggtgatg 6641566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 307
Target Start/End: Original strand, 7813303 - 7813419
Alignment:
191 ctctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaa 290  Q
    |||||| ||||||||||| || || ||| || | || || |||||||| || ||||||||||| || || || ||||| || || ||||| || |||||     
7813303 ctctcccatcaccaaaaatgaagtttttgctaccctcaagtctatgaaaccttacaaagccccaggacctgacggtttccattgtatcttcttcaaacag 7813402  T
291 tactggcatattgttgg 307  Q
    |||||||||||||||||    
7813403 tactggcatattgttgg 7813419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 312
Target Start/End: Complemental strand, 24894467 - 24894389
Alignment:
234 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 312  Q
    ||||| || ||||||||||||||| | ||||| || || || |||||||| |||||||| |||||||| ||||||||||    
24894467 atgaaaccatacaaagcccctggctcggatggattccattgtatctttttcaaacaatattggcatatagttggagatg 24894389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 198 - 312
Target Start/End: Original strand, 35232972 - 35233086
Alignment:
198 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 297  Q
    ||||| ||||| || |||||| |||| || || || ||||| ||||||||||| || || || |||||||| || ||||| || || || ||||| ||||    
35232972 atcactaaaaatgaagtctttgctgccctaaactccatgaaaccctacaaagctccaggaccagatggtttccattgcatattcttcaagcaatattggc 35233071  T
298 atattgttggagatg 312  Q
    ||||| |||||||||    
35233072 atattattggagatg 35233086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University