View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19647_low_2 (Length: 337)
Name: NF19647_low_2
Description: NF19647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19647_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 101 - 281
Target Start/End: Complemental strand, 44096458 - 44096282
Alignment:
| Q |
101 |
ggaattatgtactgaccatcatatcaaatataactcgatacccctttgttacatcgataccccttgcttgacatcattaacgtgcaatcttttagctagt |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
44096458 |
ggaattatgtactgaccat---atcaaatataactcgatacccatttgttacatcgataccctttatttgacatcattaacgtgcaatcttttagctagt |
44096362 |
T |
 |
| Q |
201 |
taaaagccaaacgtaataaccttgtttttgactactacatgtggcggttaaatcttttaatttcttgtaagagttctcttt |
281 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44096361 |
taaaagcc-aacgtaataactttgtttttgactactacatgtggcggttaaatcttttaatttcttttaagagttctcttt |
44096282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University