View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19647_low_3 (Length: 324)

Name: NF19647_low_3
Description: NF19647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19647_low_3
NF19647_low_3
[»] chr3 (1 HSPs)
chr3 (12-231)||(10465662-10465881)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 10465662 - 10465881
Alignment:
12 atgaactacgtgacgggacaaaaacaattgcagtcaaatggagaagagtaaaacaaagtccaaacaataatatctcatgagaatctgagcagtcaaccct 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
10465662 atgaactacgtgacgggacaaaaacaattgcagtcaaatggagaagagtaaaacaaagtccaaacaataatatctcatgagaatctgagaagtcaaccct 10465761  T
112 tgaaatcaaccactgaattcaaggaaagatttactattacagaggaacctgggtggacttcgagtacgaccctgttgcagatttattggagttttttgaa 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
10465762 tgaaatcaaccactgaattcaaggaaagatttactattacagaggaacctgggtggactccgagtacgaccctgttgcagatttattggagttttttgaa 10465861  T
212 tagtaaaggaaaatggacaa 231  Q
    ||||||||||||||||||||    
10465862 tagtaaaggaaaatggacaa 10465881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University