View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19647_low_3 (Length: 324)
Name: NF19647_low_3
Description: NF19647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19647_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 10465662 - 10465881
Alignment:
| Q |
12 |
atgaactacgtgacgggacaaaaacaattgcagtcaaatggagaagagtaaaacaaagtccaaacaataatatctcatgagaatctgagcagtcaaccct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10465662 |
atgaactacgtgacgggacaaaaacaattgcagtcaaatggagaagagtaaaacaaagtccaaacaataatatctcatgagaatctgagaagtcaaccct |
10465761 |
T |
 |
| Q |
112 |
tgaaatcaaccactgaattcaaggaaagatttactattacagaggaacctgggtggacttcgagtacgaccctgttgcagatttattggagttttttgaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465762 |
tgaaatcaaccactgaattcaaggaaagatttactattacagaggaacctgggtggactccgagtacgaccctgttgcagatttattggagttttttgaa |
10465861 |
T |
 |
| Q |
212 |
tagtaaaggaaaatggacaa |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10465862 |
tagtaaaggaaaatggacaa |
10465881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University