View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19647_low_5 (Length: 256)
Name: NF19647_low_5
Description: NF19647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19647_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 238
Target Start/End: Original strand, 5799706 - 5799935
Alignment:
| Q |
9 |
ataatacttggaagatttggcttgaggtctgttgtcaactgaagagcaataagagaaccatttggatctagggtacctaaaacagctctcgagtctccaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799706 |
ataatacttggaagatttggcttgaggtctgttgtcaactgaagagcaataagagaaccatttggatctagggtacctaaaacagctctcgagtctccaa |
5799805 |
T |
|
| Q |
109 |
catttgcagtaactagtttgtcgccctgaaacaagaagaatgagtgaggaatgcgcacataagtannnnnnnctctcattcttttaacgaaataagatga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5799806 |
catttgcagtaactagtttgtcgccctgaaacaagaagaatgagtgaggaatgcgcacataagtatttttttctctcattcttttaacgaaataagatga |
5799905 |
T |
|
| Q |
209 |
aaagaaatgaaatagcgtacatgccttctt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5799906 |
aaagaaatgaaatagcgtacatgccttctt |
5799935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University