View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19647_low_6 (Length: 246)
Name: NF19647_low_6
Description: NF19647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19647_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 1282734 - 1282937
Alignment:
| Q |
1 |
tgcaccattcgcaaatagcattttatcttttctctatcgaatttatcataaatttcttctaaagtgaacaatttatagagggcagaatatgtttatcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
1282734 |
tgcaccattcgcaaatagcattttatcttttctctatcaaatttatcataaatttcttctaaagtgaacaatttatagagggcggaatatgttcatcgta |
1282833 |
T |
 |
| Q |
101 |
tacaatatatcgtagcatttatcattttttgttctgaggaacataccagcattactcacacacatacacacttagtgttgagaaatgagaaattaaaaat |
200 |
Q |
| |
|
|||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1282834 |
tacatttaat---------tatcattttttgttctgaggaacataccagcattactcacacacatacacacttagtgttgagaaatgagaaattaaaaat |
1282924 |
T |
 |
| Q |
201 |
ttgagttgtactt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1282925 |
ttgagttgtactt |
1282937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University