View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19648_high_12 (Length: 360)
Name: NF19648_high_12
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19648_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 14 - 344
Target Start/End: Original strand, 49940687 - 49941019
Alignment:
| Q |
14 |
ataaaatactaggacacaacaagggaggtgggtgagtgcaatataaccacactcaatggaatagaataggattcaataaaaataacatataattttatag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49940687 |
ataaaatactaggacacaacaagggaggtgggtgagtgcaatataaccacactcaatggaatagaatcggattcaataaaaataacatataattttatag |
49940786 |
T |
|
| Q |
114 |
gatattttatgatagaataaaaggaagttttccatttcgttatttgtcagtgaacaacatggtaaggagattagttaacattaagttggctgctggttcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49940787 |
gatattttatgatagaataaaaggaagttttccatttcgttatttgtcagtgaacaacatggtaaggagattagttaacattaagttggctgctggttcc |
49940886 |
T |
|
| Q |
214 |
atccaacaactccaaattcaggggaggagaa--agnnnnnnnnngaggtgtgttgtatgaaatggaatagattctgttgagctcgattccaccttatttt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49940887 |
atccaacaactccaaattcaggggaggagaaagagaaaaaaaaagaggtgtgttgtatgaaatggaatagattctgttgagctcgattccaccttatttt |
49940986 |
T |
|
| Q |
312 |
aaataatccaagtaacaactagtaatatctttc |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49940987 |
aaataatccaagtaacaactagtaatatctttc |
49941019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University