View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19648_high_18 (Length: 320)
Name: NF19648_high_18
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19648_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 24 - 300
Target Start/End: Complemental strand, 7119708 - 7119433
Alignment:
| Q |
24 |
ggattgtggattcatggtcgaggtttgtaaagtgaaacctttatagataaacacaaatcgttacaggctgcttaaaagtacagtagaagcacatagaaga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7119708 |
ggattgtggattcatggtcgaggtttgtaaagtgaaacctttatagataaacacaaatcgttacaggctgcttaaaagtacagtagaagcacatagagga |
7119609 |
T |
 |
| Q |
124 |
ttacagctcccagaaatatttcttcatgagaagagttcgctttgcaaaatttcactatcaataaggcattattcttggaacaataagtgctctggatcaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7119608 |
ttacagctcccagaaatatttcttcatgagaagagttcgctttgcaaaattccactatcaataa-gcattattcttggaacaataagtgctctggatcaa |
7119510 |
T |
 |
| Q |
224 |
aagtgaactgttctgaattgaaagtaaggaatatgaggaagtcaatgagctgatatgaaataccgaagctcagatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7119509 |
aagtgaactgttctgaattgaaagtaaggaatatgaggaagtcaatgaactgatatgaaataccgaagctcagatca |
7119433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University