View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19648_high_25 (Length: 212)

Name: NF19648_high_25
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19648_high_25
NF19648_high_25
[»] chr5 (1 HSPs)
chr5 (37-197)||(27844584-27844744)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 37 - 197
Target Start/End: Complemental strand, 27844744 - 27844584
Alignment:
37 ttaacatgttattttatgtgcagtccgataaggcgtcgttgctggcggaagtggtgcagcacgtgaaacggttgaagaaggaagctgatgaaatggcgaa 136  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27844744 ttaacatgttattttatgtgcagtccgataaggcgtcgttgctggcggaagtggtgcagcacgtgaaacggttgaagaaggaagctgatgaaatggcgaa 27844645  T
137 tcgtcacaatgatggagagtcttcttcttcgtgcagcggagaacctggttcagttaattct 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27844644 tcgtcacaatgatggagagtcttcttcttcgtgcagcggagaacctggttcagttaattct 27844584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University