View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19648_low_23 (Length: 269)
Name: NF19648_low_23
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19648_low_23 |
 |  |
|
| [»] scaffold0867 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0867 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0867
Description:
Target: scaffold0867; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 67
Target Start/End: Complemental strand, 2428 - 2381
Alignment:
| Q |
20 |
atcacgccccttacaaacttatcaacacattttagtgtcgtggtttca |
67 |
Q |
| |
|
||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
2428 |
atcacaccccttataaacttatcaacacactttagtgtcgtggtttca |
2381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 187
Target Start/End: Original strand, 9212257 - 9212311
Alignment:
| Q |
133 |
gaaaatactcatcatgttgatcaagagcttcaacaacatgaaggaacacatgttt |
187 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| | |||||||| |||||||| |
|
|
| T |
9212257 |
gaaaatactcatcatgttgatcaagagtttcaactatgtgaaggaaaacatgttt |
9212311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 5190204 - 5190171
Alignment:
| Q |
34 |
aaacttatcaacacattttagtgtcgtggtttca |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5190204 |
aaacttatcaacacattttagtgtcgtggtttca |
5190171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 9681219 - 9681186
Alignment:
| Q |
34 |
aaacttatcaacacattttagtgtcgtggtttca |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
9681219 |
aaacttatcaacacattttagtgtcgtggattca |
9681186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 194
Target Start/End: Complemental strand, 1885746 - 1885685
Alignment:
| Q |
133 |
gaaaatactcatcatgttgatcaagagcttcaacaacatgaaggaacacatgtttttgcatt |
194 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| | ||||||| |||||||| |||||| |
|
|
| T |
1885746 |
gaaaatattcatcatgttgaccaagagcttcaactatgcgaaggaagacatgtttatgcatt |
1885685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University