View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19648_low_23 (Length: 269)

Name: NF19648_low_23
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19648_low_23
NF19648_low_23
[»] scaffold0867 (1 HSPs)
scaffold0867 (20-67)||(2381-2428)
[»] chr7 (1 HSPs)
chr7 (133-187)||(9212257-9212311)
[»] chr8 (2 HSPs)
chr8 (34-67)||(5190171-5190204)
chr8 (34-67)||(9681186-9681219)
[»] chr6 (1 HSPs)
chr6 (133-194)||(1885685-1885746)


Alignment Details
Target: scaffold0867 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0867
Description:

Target: scaffold0867; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 67
Target Start/End: Complemental strand, 2428 - 2381
Alignment:
20 atcacgccccttacaaacttatcaacacattttagtgtcgtggtttca 67  Q
    ||||| ||||||| ||||||||||||||| ||||||||||||||||||    
2428 atcacaccccttataaacttatcaacacactttagtgtcgtggtttca 2381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 187
Target Start/End: Original strand, 9212257 - 9212311
Alignment:
133 gaaaatactcatcatgttgatcaagagcttcaacaacatgaaggaacacatgttt 187  Q
    ||||||||||||||||||||||||||| |||||| |  |||||||| ||||||||    
9212257 gaaaatactcatcatgttgatcaagagtttcaactatgtgaaggaaaacatgttt 9212311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 5190204 - 5190171
Alignment:
34 aaacttatcaacacattttagtgtcgtggtttca 67  Q
    ||||||||||||||||||||||||||||||||||    
5190204 aaacttatcaacacattttagtgtcgtggtttca 5190171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 9681219 - 9681186
Alignment:
34 aaacttatcaacacattttagtgtcgtggtttca 67  Q
    ||||||||||||||||||||||||||||| ||||    
9681219 aaacttatcaacacattttagtgtcgtggattca 9681186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 194
Target Start/End: Complemental strand, 1885746 - 1885685
Alignment:
133 gaaaatactcatcatgttgatcaagagcttcaacaacatgaaggaacacatgtttttgcatt 194  Q
    ||||||| |||||||||||| ||||||||||||| |   ||||||| |||||||| ||||||    
1885746 gaaaatattcatcatgttgaccaagagcttcaactatgcgaaggaagacatgtttatgcatt 1885685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University