View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19648_low_26 (Length: 212)
Name: NF19648_low_26
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19648_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 37 - 197
Target Start/End: Complemental strand, 27844744 - 27844584
Alignment:
| Q |
37 |
ttaacatgttattttatgtgcagtccgataaggcgtcgttgctggcggaagtggtgcagcacgtgaaacggttgaagaaggaagctgatgaaatggcgaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844744 |
ttaacatgttattttatgtgcagtccgataaggcgtcgttgctggcggaagtggtgcagcacgtgaaacggttgaagaaggaagctgatgaaatggcgaa |
27844645 |
T |
 |
| Q |
137 |
tcgtcacaatgatggagagtcttcttcttcgtgcagcggagaacctggttcagttaattct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844644 |
tcgtcacaatgatggagagtcttcttcttcgtgcagcggagaacctggttcagttaattct |
27844584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University