View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19648_low_3 (Length: 648)

Name: NF19648_low_3
Description: NF19648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19648_low_3
NF19648_low_3
[»] chr5 (9 HSPs)
chr5 (14-630)||(42740359-42740985)
chr5 (11-254)||(21744565-21744809)
chr5 (349-623)||(21744851-21745123)
chr5 (533-580)||(3173849-3173896)
chr5 (531-579)||(18740033-18740081)
chr5 (533-579)||(32863333-32863380)
chr5 (536-579)||(43299937-43299980)
chr5 (534-566)||(26063055-26063087)
chr5 (533-566)||(35635863-35635896)
[»] chr1 (7 HSPs)
chr1 (406-510)||(180921-181025)
chr1 (533-579)||(26354696-26354742)
chr1 (536-577)||(324368-324409)
chr1 (533-566)||(26014229-26014262)
chr1 (533-578)||(48183914-48183958)
chr1 (534-566)||(18994627-18994659)
chr1 (533-579)||(3288473-3288519)
[»] chr2 (4 HSPs)
chr2 (406-505)||(6960271-6960370)
chr2 (406-505)||(6967701-6967800)
chr2 (533-579)||(19319362-19319408)
chr2 (533-579)||(25697954-25697998)
[»] chr6 (3 HSPs)
chr6 (533-579)||(14125097-14125143)
chr6 (533-579)||(16497559-16497606)
chr6 (534-566)||(7170730-7170762)
[»] chr4 (8 HSPs)
chr4 (533-579)||(8433370-8433416)
chr4 (533-579)||(46164750-46164797)
chr4 (534-579)||(14800358-14800404)
chr4 (534-579)||(23218585-23218628)
chr4 (531-580)||(44504332-44504382)
chr4 (534-566)||(21421933-21421965)
chr4 (534-566)||(33754314-33754346)
chr4 (533-565)||(47825605-47825637)
[»] chr7 (10 HSPs)
chr7 (531-579)||(21453178-21453227)
chr7 (534-585)||(25533957-25534007)
chr7 (531-579)||(12003328-12003377)
chr7 (537-580)||(42004879-42004922)
chr7 (533-579)||(21358374-21358419)
chr7 (534-579)||(31418966-31419012)
chr7 (542-579)||(6472697-6472735)
chr7 (542-580)||(18886296-18886334)
chr7 (536-578)||(44660056-44660097)
chr7 (11-63)||(20218029-20218081)
[»] chr3 (6 HSPs)
chr3 (531-579)||(52893141-52893190)
chr3 (534-581)||(2339179-2339227)
chr3 (537-578)||(9456119-9456161)
chr3 (534-566)||(40922562-40922594)
chr3 (534-566)||(2733345-2733377)
chr3 (533-565)||(38000596-38000628)
[»] chr8 (9 HSPs)
chr8 (534-580)||(1667822-1667869)
chr8 (533-580)||(32381197-32381244)
chr8 (533-580)||(32435152-32435199)
chr8 (534-580)||(16658527-16658574)
chr8 (534-580)||(33360100-33360147)
chr8 (542-578)||(775081-775117)
chr8 (542-578)||(780735-780771)
chr8 (534-562)||(14383450-14383478)
chr8 (537-581)||(43915826-43915869)
[»] scaffold1160 (1 HSPs)
scaffold1160 (531-576)||(2168-2214)
[»] scaffold0005 (1 HSPs)
scaffold0005 (534-579)||(39323-39369)


Alignment Details
Target: chr5 (Bit Score: 445; Significance: 0; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 14 - 630
Target Start/End: Original strand, 42740359 - 42740985
Alignment:
14 agattgaaccgatgagaccttcggtttatggttaaatcagttcaaccggttaaaccgttatgaaccattattgaaccggttaatgaataaataaatatga 113  Q
    |||||||||||||||||||||||||| |||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
42740359 agattgaaccgatgagaccttcggttcatggttcaatcggttcaaccgattaaaccgttatgaaccattattgaaccggttaatgaataaataaatatga 42740458  T
114 agataaatcaagaaaaacctctaaagattttattaattttcatattttaatgcaaccctagatattaatccatttagttgactcattgggaccaagtcca 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||    
42740459 agataaatcaagaaaaacctctaaagattttattaattttcatattttaatgcaaccctagatattaatccatttaattgactcattgggcccaagtcca 42740558  T
214 aatcaaagtatccaaccctagatataaattagttgttgtatgactttgtatcacatttgttggtaatatttcctaagtcgccgctaacaaactttctctt 313  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
42740559 aatcaaagtatccaaccctagatataaattagttgttgtatgac-ttgtatcacatttgttagtaatatttcctaagtcgccgctaacaaactttctctt 42740657  T
314 tcgttctactgtagttcatgtttcnnnnnnncctt------------tccttatttcttcctcatgcttagagaccacaatttctacaaaagcaaactaa 401  Q
    ||||||||||||||||||||||||       | ||            |||||||||||||||||||||||||||||||||||||||||||||||||||||    
42740658 tcgttctactgtagttcatgtttcttttttcctttccttattccttctccttatttcttcctcatgcttagagaccacaatttctacaaaagcaaactaa 42740757  T
402 aagcttaacatcacactcattccactcggtatccagcacaaagcaagttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaag 501  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42740758 aagcttaacatcacactcattccactcggtatccagcataaagcaagttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaag 42740857  T
502 cagtatataacnnnnnnnnnnnnnnnnnnaggatggggtggcggtggctcccccttgcca-cccccagttccgccactgctccacatccggacatgcaaa 600  Q
    |||||||||||                  ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||    
42740858 cagtatataac--ttttttttctttttttaggatggggtggcggtggctcccccttgccaccccccagttccgccactgctccacatctggacatgcaaa 42740955  T
601 gttgtgactcatgagacataatgttgcacg 630  Q
    |||||||||||||| |||||||| ||||||    
42740956 gttgtgactcatgaaacataatgctgcacg 42740985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 254
Target Start/End: Original strand, 21744565 - 21744809
Alignment:
11 cagagattgaaccgatgagaccttcggtttatggttaaatcagttcaaccggttaaaccgttatgaaccattattgaaccggttaatgaataaataaata 110  Q
    |||||||||||||||||||| |||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21744565 cagagattgaaccgatgagatcttcggttcatggttcaatcggttcaaccggttaaaccgttatgaaccattattgaaccggttaatgaataaataaata 21744664  T
111 tgaagataaatcaagaaaaacctctaaagattttattaattttcatattttaatgcaaccctagatattaatccatttagttgactcattgggaccaagt 210  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || |||    
21744665 tgaagataaatcaagaaaaacct-taaagattttattaattttcatattttaatgcaaccctagatattaatccatttagttgactcattggcccctagt 21744763  T
211 ccaaatcaaagtatccaaccctagatataaatt--agttgttgtat 254  Q
    |||||||||||||||||||||||||||||||||  |||||||||||    
21744764 ccaaatcaaagtatccaaccctagatataaattacagttgttgtat 21744809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 349 - 623
Target Start/End: Original strand, 21744851 - 21745123
Alignment:
349 tccttatttcttcctcatgcttagagaccacaatttctacaaaagcaaactaaaagcttaacatcacactcattccactcggtatccagcacaaagcaag 448  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||    
21744851 tccttatttcttcctcatgcttagagaccacaatttctacaaaagcaaattaaaagcttaacatcccactcattccactcggtatccagcacaaagcaag 21744950  T
449 ttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaagcagtatataacnnnnnnnnnnnnnnnnnnaggatggggtggcggtgg 548  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||    
21744951 ttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaagcagtatataac---tttttttttatttttaggatggggtggcggtgg 21745047  T
549 ctcccccttgcca-cccccagttccgccactgctccacatccggacatgcaaagttgtgactcatgagacataatg 623  Q
    ||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||    
21745048 ctcccccttgccaccccccagttccgccactgctccatatccagacatgcaaagttgtgactcatgagatataatg 21745123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 533 - 580
Target Start/End: Complemental strand, 3173896 - 3173849
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactgc 580  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
3173896 gatggggtggcggtggctcccccttgccacccccagttccgccactgc 3173849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 531 - 579
Target Start/End: Original strand, 18740033 - 18740081
Alignment:
531 aggatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||    
18740033 aggatggggtggcggtggctcccccttgccaaccccagttccgccactg 18740081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 533 - 579
Target Start/End: Complemental strand, 32863380 - 32863333
Alignment:
533 gatggggtggcggtggctcccccttgccac-ccccagttccgccactg 579  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||    
32863380 gatggggtggcggtggctcccccttgccaccccccagttccgccactg 32863333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 536 - 579
Target Start/End: Complemental strand, 43299980 - 43299937
Alignment:
536 ggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    |||||||||||||||||||||||||| |||||||||||||||||    
43299980 ggggtggcggtggctcccccttgccaaccccagttccgccactg 43299937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 566
Target Start/End: Complemental strand, 26063087 - 26063055
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||||||||||||||    
26063087 atggggtggcggtggctcccccttgccaccccc 26063055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 533 - 566
Target Start/End: Original strand, 35635863 - 35635896
Alignment:
533 gatggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||| |||||||||||    
35635863 gatggggtggcggtggctccccattgccaccccc 35635896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 85; Significance: 3e-40; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 406 - 510
Target Start/End: Complemental strand, 181025 - 180921
Alignment:
406 ttaacatcacactcattccactcggtatccagcacaaagcaagttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaagcagt 505  Q
    |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||    
181025 ttaacatcacactcgttccactcggtatccagcgcaaagcaagttcattttcaagtactttaaactggctcagtagaacagaaaaaactccagaagcagt 180926  T
506 atata 510  Q
    |||||    
180925 atata 180921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 533 - 579
Target Start/End: Complemental strand, 26354742 - 26354696
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
26354742 gatggggtggcggtggctcccccttgccacctccagttccgccactg 26354696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 536 - 577
Target Start/End: Complemental strand, 324409 - 324368
Alignment:
536 ggggtggcggtggctcccccttgccacccccagttccgccac 577  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
324409 ggggtggcggtggctcccccttgccacccccagatccgccac 324368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 533 - 566
Target Start/End: Complemental strand, 26014262 - 26014229
Alignment:
533 gatggggtggcggtggctcccccttgccaccccc 566  Q
    ||||||||||||||||||||||||||||||||||    
26014262 gatggggtggcggtggctcccccttgccaccccc 26014229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 533 - 578
Target Start/End: Complemental strand, 48183958 - 48183914
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccact 578  Q
    |||| |||||||||||||||||||||||| ||||||||||||||||    
48183958 gatgtggtggcggtggctcccccttgcca-ccccagttccgccact 48183914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 566
Target Start/End: Original strand, 18994627 - 18994659
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||||||||||||||    
18994627 atggggtggcggtggctcccccttgccaccccc 18994659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 3288473 - 3288519
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    ||||||||||| |||||||||||||| || |||| ||||||||||||    
3288473 gatggggtggccgtggctcccccttgtcaaccccggttccgccactg 3288519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 84; Significance: 1e-39; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 406 - 505
Target Start/End: Original strand, 6960271 - 6960370
Alignment:
406 ttaacatcacactcattccactcggtatccagcacaaagcaagttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaagcagt 505  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||    
6960271 ttaacatcacactcattccactcggtatccagcgcaaagcaagttcattttcaagtactttaaactggcttagtcggacagaaaaaacaccagaagcagt 6960370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 406 - 505
Target Start/End: Original strand, 6967701 - 6967800
Alignment:
406 ttaacatcacactcattccactcggtatccagcacaaagcaagttcattttcaagtactttaaactggttcagtaggacagaaaaaacaccagaagcagt 505  Q
    ||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||  ||| |||||   | |||||||||||||||| ||||    
6967701 ttaacatcacattcattccactcagtatccagcaaaaagcaagttcattttcaagtactttaagatggctcagtcaaatagaaaaaacaccagaaacagt 6967800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 19319362 - 19319408
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    ||||||||||||||||||| ||||||||| || ||||||||||||||    
19319362 gatggggtggcggtggctctcccttgccaacctcagttccgccactg 19319408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 25697954 - 25697998
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    |||||||||||| |||||||||||||||| |||||||||||||||||    
25697954 gatggggtggcg-tggctcccccttgcca-ccccagttccgccactg 25697998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 14125097 - 14125143
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||    
14125097 gatggggtagcggtggctcccccttgccacccccagttccgccactg 14125143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 16497559 - 16497606
Alignment:
533 gatggggtggcggtggctcccccttgccacccc-cagttccgccactg 579  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||    
16497559 gatggggtggcggtggctcccccttgccaccccgcagttccgccactg 16497606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 566
Target Start/End: Complemental strand, 7170762 - 7170730
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||||||||||||||    
7170762 atggggtggcggtggctcccccttgccaccccc 7170730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 8433370 - 8433416
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    
8433370 gatggggtggcggtggctcccccttgccacccccggttccgccactg 8433416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 46164750 - 46164797
Alignment:
533 gatggggtggcggtggctcccccttgccacc-cccagttccgccactg 579  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||    
46164750 gatggagtggcggtggctcccccttgccaccacccagttccgccactg 46164797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 534 - 579
Target Start/End: Original strand, 14800358 - 14800404
Alignment:
534 atggggtggcggtggctcccccttgccaccccc-agttccgccactg 579  Q
    |||||||||| |||||||||||||||||||||| |||||||||||||    
14800358 atggggtggctgtggctcccccttgccaccccctagttccgccactg 14800404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 534 - 579
Target Start/End: Original strand, 23218585 - 23218628
Alignment:
534 atggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    |||||||||||||||||||||  |||||||||||||||||||||||    
23218585 atggggtggcggtggctcccc--tgccacccccagttccgccactg 23218628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 531 - 580
Target Start/End: Complemental strand, 44504382 - 44504332
Alignment:
531 aggatggggtggcggtggctcccccttgcc-acccccagttccgccactgc 580  Q
    |||||||||||||||||||||||||||||| ||||| ||||||||| ||||    
44504382 aggatggggtggcggtggctcccccttgccaacccctagttccgcccctgc 44504332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 566
Target Start/End: Complemental strand, 21421965 - 21421933
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||||||||||||||    
21421965 atggggtggcggtggctcccccttgccaccccc 21421933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 566
Target Start/End: Original strand, 33754314 - 33754346
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||||||||||||||    
33754314 atggggtggcggtggctcccccttgccaccccc 33754346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 533 - 565
Target Start/End: Complemental strand, 47825637 - 47825605
Alignment:
533 gatggggtggcggtggctcccccttgccacccc 565  Q
    |||||||||||||||||||||||||||||||||    
47825637 gatggggtggcggtggctcccccttgccacccc 47825605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 531 - 579
Target Start/End: Original strand, 21453178 - 21453227
Alignment:
531 aggatggggtggcggtggctcccccttgcca-cccccagttccgccactg 579  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||    
21453178 aggatggggtggcggtggctcccccttgccaccccccagttccgccactg 21453227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 534 - 585
Target Start/End: Complemental strand, 25534007 - 25533957
Alignment:
534 atggggtggcggtggctcccccttgccacccccagttccgccactgctccac 585  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||    
25534007 atggggtggcggtggctcccccttgcca-ccccagttccgccactgcaccac 25533957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 531 - 579
Target Start/End: Original strand, 12003328 - 12003377
Alignment:
531 aggatggggtggcggtggctcccccttgcca-cccccagttccgccactg 579  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||||||    
12003328 aggatggggtggcggtggctcctccttgccaccccccagttccgccactg 12003377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 537 - 580
Target Start/End: Complemental strand, 42004922 - 42004879
Alignment:
537 gggtggcggtggctcccccttgccacccccagttccgccactgc 580  Q
    ||||||| ||||||||||||| ||||||||||||||||||||||    
42004922 gggtggcagtggctcccccttaccacccccagttccgccactgc 42004879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 533 - 579
Target Start/End: Original strand, 21358374 - 21358419
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactg 579  Q
    ||||||||||||||||||||||||| ||| |||||||||||||||||    
21358374 gatggggtggcggtggctcccccttacca-ccccagttccgccactg 21358419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 534 - 579
Target Start/End: Complemental strand, 31419012 - 31418966
Alignment:
534 atggggtggcggtggctcccccttgccac-ccccagttccgccactg 579  Q
    ||||||||||||||||||||||||||||| |||| ||||||||||||    
31419012 atggggtggcggtggctcccccttgccaccccccggttccgccactg 31418966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 579
Target Start/End: Original strand, 6472697 - 6472735
Alignment:
542 gcggtggctcccccttgcca-cccccagttccgccactg 579  Q
    |||||||||||||||||||| ||||||||||||||||||    
6472697 gcggtggctcccccttgccaccccccagttccgccactg 6472735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 580
Target Start/End: Complemental strand, 18886334 - 18886296
Alignment:
542 gcggtggctcccccttgccacccccagttccgccactgc 580  Q
    ||||| ||||||||||||||||| |||||||||||||||    
18886334 gcggtcgctcccccttgccaccctcagttccgccactgc 18886296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 536 - 578
Target Start/End: Complemental strand, 44660097 - 44660056
Alignment:
536 ggggtggcggtggctcccccttgccacccccagttccgccact 578  Q
    |||||||||||||||||||||||||| ||||||||||| ||||    
44660097 ggggtggcggtggctcccccttgcca-ccccagttccggcact 44660056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 11 - 63
Target Start/End: Complemental strand, 20218081 - 20218029
Alignment:
11 cagagattgaaccgatgagaccttcggtttatggttaaatcagttcaaccggt 63  Q
    |||||||||||||| |||||||||||||| |||||| || | ||| |||||||    
20218081 cagagattgaaccggtgagaccttcggttcatggttcaaccggttgaaccggt 20218029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 531 - 579
Target Start/End: Complemental strand, 52893190 - 52893141
Alignment:
531 aggatggggtggcggtggctcccccttgcc-acccccagttccgccactg 579  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||    
52893190 aggatggggtggcggtggctcccccttgccaacccccagttccgccactg 52893141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 534 - 581
Target Start/End: Original strand, 2339179 - 2339227
Alignment:
534 atggggtggcggtggctcccccttgcca-cccccagttccgccactgct 581  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||    
2339179 atggggtggcggtggctcccccttgccaccccccagttccgccactgct 2339227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 537 - 578
Target Start/End: Complemental strand, 9456161 - 9456119
Alignment:
537 gggtggcggtggctcccccttgccac-ccccagttccgccact 578  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
9456161 gggtggcggtggctcccccttgccaccccccagttccgccact 9456119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 566
Target Start/End: Complemental strand, 40922594 - 40922562
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||||||||||||||||||||||||||    
40922594 atggggtggcggtggctcccccttgccaccccc 40922562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 534 - 566
Target Start/End: Complemental strand, 2733377 - 2733345
Alignment:
534 atggggtggcggtggctcccccttgccaccccc 566  Q
    |||||||||| ||||||||||||||||||||||    
2733377 atggggtggctgtggctcccccttgccaccccc 2733345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 533 - 565
Target Start/End: Original strand, 38000596 - 38000628
Alignment:
533 gatggggtggcggtggctcccccttgccacccc 565  Q
    ||||||||||| |||||||||||||||||||||    
38000596 gatggggtggccgtggctcccccttgccacccc 38000628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 534 - 580
Target Start/End: Complemental strand, 1667869 - 1667822
Alignment:
534 atggggtggcggtggctcccccttgccac-ccccagttccgccactgc 580  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||    
1667869 atggggtggcggtggctcccccttgccaccccccagttccgccactgc 1667822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 533 - 580
Target Start/End: Complemental strand, 32381244 - 32381197
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactgc 580  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||    
32381244 gatggggtggcggtggctcccccttgccacccccggctccgccactgc 32381197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 533 - 580
Target Start/End: Complemental strand, 32435199 - 32435152
Alignment:
533 gatggggtggcggtggctcccccttgccacccccagttccgccactgc 580  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||    
32435199 gatggggtggcggtggctcccccttgccacccccggctccgccactgc 32435152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 580
Target Start/End: Complemental strand, 16658574 - 16658527
Alignment:
534 atggggtggcggtggctcccccttgccac-ccccagttccgccactgc 580  Q
    |||||||||||||| |||||||||||||| ||||||||||||||||||    
16658574 atggggtggcggtgtctcccccttgccaccccccagttccgccactgc 16658527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 580
Target Start/End: Complemental strand, 33360147 - 33360100
Alignment:
534 atggggtggcggtggctcccccttgccaccccc-agttccgccactgc 580  Q
    ||||||||||||||||||||||||||||||||| | ||||||||||||    
33360147 atggggtggcggtggctcccccttgccaccccctaattccgccactgc 33360100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 542 - 578
Target Start/End: Original strand, 775081 - 775117
Alignment:
542 gcggtggctcccccttgccacccccagttccgccact 578  Q
    |||||||||| |||||||||||| |||||||||||||    
775081 gcggtggctcgcccttgccacccgcagttccgccact 775117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 542 - 578
Target Start/End: Original strand, 780735 - 780771
Alignment:
542 gcggtggctcccccttgccacccccagttccgccact 578  Q
    |||||||||| |||||||||||| |||||||||||||    
780735 gcggtggctcgcccttgccacccgcagttccgccact 780771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 534 - 562
Target Start/End: Complemental strand, 14383478 - 14383450
Alignment:
534 atggggtggcggtggctcccccttgccac 562  Q
    |||||||||||||||||||||||||||||    
14383478 atggggtggcggtggctcccccttgccac 14383450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 581
Target Start/End: Complemental strand, 43915869 - 43915826
Alignment:
537 gggtggcggtggctcccccttgccacccccagttccgccactgct 581  Q
    |||||||||||||||| |||||||| ||||||||| |||||||||    
43915869 gggtggcggtggctcctccttgcca-ccccagttcagccactgct 43915826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1160 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold1160
Description:

Target: scaffold1160; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 531 - 576
Target Start/End: Complemental strand, 2214 - 2168
Alignment:
531 aggatggggtggcggtggctcccccttgccaccccc-agttccgcca 576  Q
    ||||||||||||||||||||||||||| |||||||| ||||||||||    
2214 aggatggggtggcggtggctcccccttaccaccccctagttccgcca 2168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 534 - 579
Target Start/End: Complemental strand, 39369 - 39323
Alignment:
534 atggggtggcggtggctcccccttgccaccccc-agttccgccactg 579  Q
    |||||||||| |||||||||||||||||||||| |||||||||||||    
39369 atggggtggctgtggctcccccttgccaccccctagttccgccactg 39323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University