View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19649_high_3 (Length: 352)
Name: NF19649_high_3
Description: NF19649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19649_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 30 - 330
Target Start/End: Original strand, 37571822 - 37572132
Alignment:
| Q |
30 |
tttacaccaattagtttgtgatcattgtttaattacaatagttttagannnnnnnggttaccatgttataaataggaagttttcattgccgtttagcagt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37571822 |
tttacaccaattagtttgtgatcactgtttaatcacaatagttttagatttttttggttaccatgttataaataggaagttttcattgctgtttagcagt |
37571921 |
T |
|
| Q |
130 |
aactaatatccgcatagcagtaacaatacgggttctcccggtcaaccgaattttctccacccatgaccactttcttaaggggtctaaatcccttggaata |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571922 |
aactaatatccgcatagcagtaacaatacgggttctcccggtcaaccgaattt-ctccacccatgaccactttcttaaggggtctaaatcccttggaata |
37572020 |
T |
|
| Q |
230 |
gttttatgttttatataatagaggaaaacagcaatgatttgatgactcgatgcatgact-----------tgtatcagatataatatagggtggttttgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37572021 |
gttttatgttttatataatagaggaaaacagcaatgatttgatgacttgatgcatgacttgttgtatacctgtatcagatataatatagggtggttttgt |
37572120 |
T |
|
| Q |
319 |
tcttgtgatgat |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37572121 |
tcttgtgatgat |
37572132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University