View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19649_low_2 (Length: 237)
Name: NF19649_low_2
Description: NF19649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19649_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 2173245 - 2173037
Alignment:
| Q |
14 |
cataggtttagtccttaaaaatgtaagggtgggtaacactaatccttaaacaagttaatgcattaaaaattatgtaaaaacaaatcttaagtccagtaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2173245 |
cataggtttagtccttaaaaatgtaagggtgggtaacactaatccttaaacaagttaatgcattaaaaattatgtaaaaacaaatcttaagtccagtaac |
2173146 |
T |
 |
| Q |
114 |
attaacaaacttatctggcacgttaactgccatgtgtcatgctacatacgataagataagatgcttatgtggcttattaccagttagcattacctctttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2173145 |
attaacaaacttatctggcacgttaactgccatgtgtcatgctacataggataagataagatgcttatgtggcttattaccagttagcattacctctttt |
2173046 |
T |
 |
| Q |
214 |
gtactaaat |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
2173045 |
gtactaaat |
2173037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University