View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1964_low_5 (Length: 301)
Name: NF1964_low_5
Description: NF1964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1964_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 154
Target Start/End: Original strand, 18857709 - 18857844
Alignment:
| Q |
19 |
tactatgatactattcagtagttaaataaatagttcaaacgtgaattcaggagaatatagaataaagatagcagaaccgtgctaagaagtaagaactcac |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18857709 |
tactatgatactattcagtaattaaataaatagttcaaacgtgaattcgggagaatatagaataaagatagcagaaccgtgctaagaagtaagaactcac |
18857808 |
T |
|
| Q |
119 |
cgagagattatggaaacagatttgggagagaacgag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18857809 |
cgagagattatggaaacagatttgggagagaacgag |
18857844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University