View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19650_low_10 (Length: 247)
Name: NF19650_low_10
Description: NF19650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19650_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 52188902 - 52188678
Alignment:
| Q |
18 |
taacccacttggcaagaagaaaaatcagtatttatatcctaaattagcaagaggacagtgccattcatacacaaacataaatatcgaaatttaagatcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52188902 |
taacccacttggcaagaagaaaaatcagtatttatatcctaaattagcaagaggacagtgccattcatacacaaacataaatatcgaaatttaagatcat |
52188803 |
T |
|
| Q |
118 |
tgtttcgagtaagagcgtgatcttcctactgtcacacaaaaataggatttaatgaattgtgtctatgattttaagctcaattcaagaaataatatctatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52188802 |
tgtttcgagtaagagcgtgatcttcctactgtcacacaataataggatttaatgaattgtgtctatgattttaagctcaattcaagaaataatatctatg |
52188703 |
T |
|
| Q |
218 |
tcacaatccacctgcctatgcttct |
242 |
Q |
| |
|
||||||||||| || ||||| |||| |
|
|
| T |
52188702 |
tcacaatccacttgtctatgattct |
52188678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University