View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19651_high_16 (Length: 278)
Name: NF19651_high_16
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19651_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 168 - 261
Target Start/End: Complemental strand, 18863667 - 18863574
Alignment:
| Q |
168 |
gatgatatgcaaggacctctgacgacgaaacttgtgcgaaaaacaagaacataaacaaaaacgaaccaacttgaacaaccagtaacttcatatt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
18863667 |
gatgatatgcaaggacctctgacgacgaaacttgtgcgaaagacacgaacagaaacaaaaacaaaccaacttgaaccaccagtaacttcatatt |
18863574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University