View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19651_high_28 (Length: 223)
Name: NF19651_high_28
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19651_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 18863992 - 18863814
Alignment:
| Q |
17 |
ggtgagactaccaaacacaacaatttcaatcaaacgtgtaacaactcagataggaggtgatcctaatacgtcagtaaccagacaaacccccttcgggtta |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18863992 |
ggtgagactaccaaatacaacaatttcaatcaaacgtgtaacaactcagatagggcatgatcctaatacgtcagtaaccaaacaaacccccttcgggtta |
18863893 |
T |
 |
| Q |
117 |
ttaaaattggaccagactcttgcaggttatcgaaactgaatcgcgactaagctaaaatttagagcctcccgatctctgg |
195 |
Q |
| |
|
|||||| |||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18863892 |
ttaaaactggatcagactcttgcgggttatcgaaactgaaccgcgactaagctaaaatttagagcctcccaatctctgg |
18863814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University