View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19651_low_12 (Length: 312)
Name: NF19651_low_12
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19651_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 21 - 294
Target Start/End: Complemental strand, 40051192 - 40050910
Alignment:
| Q |
21 |
taattaaacattccacctaattttaagataacccctttgaatcctcaataaatttgatcactcactccctcattcccacttcaaggtccacttctccatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051192 |
taattaaacattccacctaattttaagataacccctttgaatcctcaataaatttgatcactcactccctcattcccacttcaaggtccacttctccatt |
40051093 |
T |
 |
| Q |
121 |
ctcttctcccctttcaacaaactcaagatg---------aactatcctctcttcacactctcacttctcctaatagtcctcttctatcccaccaccataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051092 |
ctcttctcccctttcaacaaactcaagatggtaaagatgaactatcctctcttcacactctcacttctcctaatagtcctcttctatcccaccaccataa |
40050993 |
T |
 |
| Q |
212 |
attcagcatctgaatcaccagcaccatcaccatcatcagccccaacagatattatccgaatcctcaaaaaagccggcggattc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40050992 |
attcagcatctgaatcaccagcaccatcaccatcatcagccccaacagatattatccgaatcctcaaaaaagccggtggattc |
40050910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University