View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19651_low_13 (Length: 304)

Name: NF19651_low_13
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19651_low_13
NF19651_low_13
[»] chr6 (2 HSPs)
chr6 (120-202)||(10653232-10653314)
chr6 (23-68)||(10653366-10653411)


Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 120 - 202
Target Start/End: Complemental strand, 10653314 - 10653232
Alignment:
120 gggtagatctaaggagatttaatctgttaatgaaataacattaaaaatttgtcttgaaaaatgatgtatttaatctaagtcaa 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10653314 gggtagatctaaggagatttaatctgttaatgaaataacattaaaaatttgtcttgaaaaatgatgtatttaatctaagtcaa 10653232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 10653411 - 10653366
Alignment:
23 aaaagagaaaatatacaagtggtgaaggtgtaaaccatacccattg 68  Q
    |||| |||||||||||||||||||||||||||||||||||||||||    
10653411 aaaaaagaaaatatacaagtggtgaaggtgtaaaccatacccattg 10653366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University