View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19651_low_27 (Length: 242)
Name: NF19651_low_27
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19651_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 225
Target Start/End: Original strand, 38583554 - 38583768
Alignment:
| Q |
11 |
agataatactaattcaggtccaaattatattttaatttgtaaaaacaacctcatctgctggggagtgatatcagtagttgagttacacttgaaggctccc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38583554 |
agatgatactaattcaggtccaaattatattttaatttgtaaaaacaacctcatctgctggggagtgatatcagtagttgagttacacttgaaggctccc |
38583653 |
T |
 |
| Q |
111 |
ccctgctttttgcttccagtgcggttgatgttcattgaaacctcttgcttctcggaatctgagtagctaaaggaaactgcaagagaaaagtagctatgtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38583654 |
ccctgctttttgcttccagtgcggttgatgttcattgaaacctcttgcttctcggaatctgaatagctaaaggaaactgcaagagaaaagtagctatgtt |
38583753 |
T |
 |
| Q |
211 |
tatgaatctttcata |
225 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
38583754 |
tatgaatcttccata |
38583768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University