View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19651_low_28 (Length: 223)

Name: NF19651_low_28
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19651_low_28
NF19651_low_28
[»] chr5 (1 HSPs)
chr5 (17-195)||(18863814-18863992)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 18863992 - 18863814
Alignment:
17 ggtgagactaccaaacacaacaatttcaatcaaacgtgtaacaactcagataggaggtgatcctaatacgtcagtaaccagacaaacccccttcgggtta 116  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||| |||||||||||||||||||    
18863992 ggtgagactaccaaatacaacaatttcaatcaaacgtgtaacaactcagatagggcatgatcctaatacgtcagtaaccaaacaaacccccttcgggtta 18863893  T
117 ttaaaattggaccagactcttgcaggttatcgaaactgaatcgcgactaagctaaaatttagagcctcccgatctctgg 195  Q
    |||||| |||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||    
18863892 ttaaaactggatcagactcttgcgggttatcgaaactgaaccgcgactaagctaaaatttagagcctcccaatctctgg 18863814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University