View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19651_low_30 (Length: 217)
Name: NF19651_low_30
Description: NF19651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19651_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 45595761 - 45595555
Alignment:
| Q |
1 |
cagtggggcttctctgcaacacttccctttccacttccttctctaaattattctttcattttcacctttcataccattattaaattccattacatattta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595761 |
cagtggggcttctctgcaacacttcactttccacttccttctctaaattattctttcattttcacctttcataccattattaaattccattacatattta |
45595662 |
T |
|
| Q |
101 |
tatgcttttcaatgttaataattatcctcatgcatttatgacacttatatttaagtcggtttacttccacagcactctttcttatcttctctcttaccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595661 |
tatgcttttcaatgttaataattatcctcatgcatttatgacacttatatttaagtcggtttacttccacagcactctttcttatcttctctcttaccct |
45595562 |
T |
|
| Q |
201 |
gatgatg |
207 |
Q |
| |
|
|||||| |
|
|
| T |
45595561 |
tatgatg |
45595555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University