View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19653_low_7 (Length: 204)
Name: NF19653_low_7
Description: NF19653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19653_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 30877849 - 30877646
Alignment:
| Q |
1 |
atggaaatggaaggttatgatatatttggagatgctactgagagaattagtaaaaatggttttgaagtaaacaatgaggtaattggaagtgggtaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30877849 |
atggaaatggaaggttatgatatatttggagatgctactgagagaattggtaaaaatggttttgaagtaaacaatgaggtaattggaagtgggtatggtt |
30877750 |
T |
|
| Q |
101 |
caagtttctctctggtttttgatagggagagagggtagcttgtagaggcacctgttaaaatggaaggaaagggtgtgtccactacagagagaagtgttga |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877749 |
caagtttctctctggttttggatagggagagaggggagcttgtagaggaacctgttaaaatggaaggaaagggtgtgtccactacagagagaagtgttga |
30877650 |
T |
|
| Q |
201 |
agct |
204 |
Q |
| |
|
|||| |
|
|
| T |
30877649 |
agct |
30877646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University