View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19654_high_13 (Length: 267)
Name: NF19654_high_13
Description: NF19654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19654_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 35 - 252
Target Start/End: Complemental strand, 54450198 - 54449981
Alignment:
| Q |
35 |
agaaatttgaggataatgaaacaaaattgaatttagcatggattaaaaccgagtgctaaaaaattatataggtaaacaaacatgcaacttttttcacgag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54450198 |
agaaatttgaggataatgaaacaaaattgaatttagcatggattaaaaccgagtgctaaaaaattatataagtaaacaaacatgcaacttttttcacgag |
54450099 |
T |
|
| Q |
135 |
catgaaaaataaaattcgttacattataagaccaaaaacttatttaattcaaatagataattttgctatcttcatttcttttcaatccaatcttgttctc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54450098 |
catgaaaaataaaattcgttacattataagaccaaaaacttatttaattcaaatagataattttgctatcttcatttcttttcaatccaatcttgttctc |
54449999 |
T |
|
| Q |
235 |
ttcctcgaggaaaatgtg |
252 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
54449998 |
ttcctcgaggaaaatgtg |
54449981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University