View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19654_low_12 (Length: 328)
Name: NF19654_low_12
Description: NF19654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19654_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 36781766 - 36781545
Alignment:
| Q |
16 |
attttaactatgcacttttagttttcaatttcagaaattgaccattcgatttgatgactttgcaatatattaggctacctgacattagatcaaagagcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36781766 |
attttaactatgcacttttagttttcaatttcagaaattgaccattcgatttgatgactttgcaatatattaggctacctgacatgagatcaaagagcat |
36781667 |
T |
|
| Q |
116 |
aattgtggagtcttaaagaatagaatggcaaattaggtcttgatcaagcatacaaagccaaaagaaaataagttgaaatcatacaaaacgtgaataattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36781666 |
aattgtggagtcttaaagaatagaatggcaaattaggttttgatcaagcatacaaagccaaaagaaaataagttgaaatgatacaaaacgtgaataattt |
36781567 |
T |
|
| Q |
216 |
atttaaattgtcacgtcatcaa |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36781566 |
atttaaattgtcacgtcatcaa |
36781545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University