View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19655_high_13 (Length: 330)
Name: NF19655_high_13
Description: NF19655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19655_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 30 - 307
Target Start/End: Complemental strand, 6315347 - 6315070
Alignment:
| Q |
30 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgcgttaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
6315347 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaa |
6315248 |
T |
 |
| Q |
130 |
tctccaaattctaagtattttgctgctttttcctttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315247 |
tctccaaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
6315148 |
T |
 |
| Q |
230 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315147 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatga |
6315070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University