View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19657_low_11 (Length: 335)
Name: NF19657_low_11
Description: NF19657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19657_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 328
Target Start/End: Original strand, 33090441 - 33090750
Alignment:
| Q |
19 |
tttttggttggtaggattgcatatatcagaccccttatggactccacaattctcattatactgatgtggtctcattaactgataatatcctaattattca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33090441 |
tttttggttggtaggattgcatatatcagaccccttatggactccacaattctcattatactgatgtggtctcattaactgataatatcctaattattca |
33090540 |
T |
 |
| Q |
119 |
ttcttgtttaaattttctatctgtgtattacttcttaatcaagattaattttgaggatgttatgttagaacaaagtgtctgtctcatgtgccaacatatt |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33090541 |
ttcttgtttaaattttctatctttgtattacttcttaatcaagattaattttgaggatgttatgttagaacaaagtgtctgtctcatgtgccaacatatt |
33090640 |
T |
 |
| Q |
219 |
tgatatatcacctacctttcttcattaagctaaagttttatgttttccaaattttctattatcatatttcatgatagatgcttttcccaacactattgtg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33090641 |
tgatatatcacctacctttcttcattaagctagagttttatgttttccaaattttctattatcatatttcatgatagatgcttttcccaacactattgtg |
33090740 |
T |
 |
| Q |
319 |
gcctatgcta |
328 |
Q |
| |
|
|||||||||| |
|
|
| T |
33090741 |
gcctatgcta |
33090750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University