View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_105 (Length: 233)
Name: NF19658_high_105
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_105 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 37302673 - 37302467
Alignment:
| Q |
12 |
aagcatagggtaatggtgtgaagctaagaaaggggacaaaaaaggagcgatgggtccaaggttaattattttcttaataagacgggttggggtatctttc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302673 |
aagcttagggtaatggtgtgaagctaagaaaggggacaaaaaaggagcgatgggtccaaggttaattattttcttaataagacgggttggggtatctttc |
37302574 |
T |
 |
| Q |
112 |
tttttgttannnnnnncctcttagagacagagatggagtgagcatttagtgaggttgccggaggatatatgatcaattaaaagccaacttgacagatggg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302573 |
tttttgttatttttttcctcttagagacagagatggagtgagcatttagtgaggttgccggaggatatatgatcaattaaaagccaacttgacagatggg |
37302474 |
T |
 |
| Q |
212 |
aaaaggt |
218 |
Q |
| |
|
||||||| |
|
|
| T |
37302473 |
aaaaggt |
37302467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University