View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19658_high_111 (Length: 214)

Name: NF19658_high_111
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19658_high_111
NF19658_high_111
[»] chr3 (1 HSPs)
chr3 (78-196)||(45458628-45458746)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 78 - 196
Target Start/End: Original strand, 45458628 - 45458746
Alignment:
78 gtcaagtaactaatggttgacctgacacgccttgagagggaagaagtgtggatttcgatgtttgaacaccgacccttgcatgttattgttcttgcaacta 177  Q
    |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
45458628 gtcaagtagctaatggttgacctgacacgccttgagaggggagaagtgtggatttcgatgtttgaacaccgacccttgcatgtcattgttcttgcaacta 45458727  T
178 acaattgaattgtaattac 196  Q
    |||||||| ||| ||||||    
45458728 acaattgagttgaaattac 45458746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University