View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_37 (Length: 431)
Name: NF19658_high_37
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 11 - 415
Target Start/End: Original strand, 49038176 - 49038580
Alignment:
| Q |
11 |
gattattctatttatctatctattctttaattggaactaggaaattctgcacgaagataaaagtccctaatttataagcacgcaaaaataaaattttgaa |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038176 |
gattattctatttatttatctattctttaattggaactaggaaattctgcacgaagataaaagtccctaatttataagcacgcaaaaataaaattttgaa |
49038275 |
T |
 |
| Q |
111 |
tttttctacatatgtttgctgacatgttattttgannnnnnnnccttctatatggtttttcattttcagaaatacgaaggaactttacttgacatagaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038276 |
tttttctacatatgtttgctgacatgttattttgttttttttcccttttatatggtttttcattttcagaaatacgaaggaactttacttgacatagaga |
49038375 |
T |
 |
| Q |
211 |
attaggtagactcaatatagaattcattcccttgtttgggagagtaaagtggattgtggtgtttaattgtgcaaagatgggggatcactttgatttattg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038376 |
attaggtagactcaatatagaattcattcccttgtttgggagagtaaagtggattgtggtgtttaattgtgcaaagatgggggatcactttgatttattg |
49038475 |
T |
 |
| Q |
311 |
gttgatcggttgctcactgaatcgacgttagaagctgcgattgaaagcagaaaccgtgcgatgcaggctgcgtcctcggaggtgactagcgcagtagtcg |
410 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49038476 |
gttgatcggttgctcactgaatcgacattagaagctgcgattgaaagcagaaaccgtgcgatgcaggctgcgtcctcggaggtgactagcgcagcagtcg |
49038575 |
T |
 |
| Q |
411 |
atcat |
415 |
Q |
| |
|
||||| |
|
|
| T |
49038576 |
atcat |
49038580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University