View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_40 (Length: 409)
Name: NF19658_high_40
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 13 - 394
Target Start/End: Complemental strand, 47894426 - 47894026
Alignment:
| Q |
13 |
aatatcagggacagggaccgaaacaacaccatcgtttgagttcaacctaccaaatttcgcatagattttggctctaagatctcttcctgattccaccctc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894426 |
aatatcagggacagggaccgaaacaacaccatcgtttgagttcaacctaccaaatttctcatagattttggctctaagatctcttcctgattccaccctc |
47894327 |
T |
 |
| Q |
113 |
tccataccaaccccttcatagtttgatggaagactcaaaaa-ccacctcgtgg------------------agaacccatcttagacaccggactccatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47894326 |
tccataccaaccccttcatagtttgatggaagactcaaaaaaccacctcgtggtcgtggagaaccaaacacagaacccatcttagacaccggactccatt |
47894227 |
T |
 |
| Q |
194 |
catcaaccctaacactcctcatgaagccaactaattccctcacgttcaccggtgggacaccgtatcgagattttcttggagaagaatcaagaactgaggt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894226 |
catcaaccctaacactcctcatgaagccaactaattccctcacgttcaccggtgggacaccgtatcgagattttcttggagaagaatcaagaactgaggt |
47894127 |
T |
 |
| Q |
294 |
aggagatgaaacaaatgattccggtgaagcgttatctgagacacggagttgatcaatggtatgagcaaagaaacaaactcgtctccggcaaagggttccg |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894126 |
aggagatgaaacaaatgattccggtgaagcgttatttgagacacggagttgatcaatggtatgagcaaagaaacaaactcgtctccggcaaagggttccg |
47894027 |
T |
 |
| Q |
394 |
t |
394 |
Q |
| |
|
| |
|
|
| T |
47894026 |
t |
47894026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University