View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_47 (Length: 376)
Name: NF19658_high_47
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 20 - 272
Target Start/End: Original strand, 40511702 - 40511954
Alignment:
| Q |
20 |
tcgtcgtggaccgaggtcacgaagctcgcagtatcgtggtgttactttctaccggagaactggacgttgggaatctcatatttggttcgcatttcgcaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40511702 |
tcgtcgtggaccgaggtcacgaagctcgcagtatcgtggtgttactttctaccggagaactggacgttgggaatctcatatttggttcgcatttcgcaat |
40511801 |
T |
 |
| Q |
120 |
cgattattctgtttcttcgtagttcagttcactttctgcatttcatgatagtgttgtttctgaatccactctgttttcgtttttctgcagggattgtgga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40511802 |
cgattattctgtttcttcgtagttcagtttactttctgcatttcatgatagtgttgtttctgaatccactctgttttcgtttttctgcagggattgtgga |
40511901 |
T |
 |
| Q |
220 |
aaacaagtatacttaggtgagaaatcattactgattgagtgattatttgagac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40511902 |
aaacaagtatacttaggtgagaaatcattactgattaagtgattatttgagac |
40511954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 343 - 376
Target Start/End: Complemental strand, 22122448 - 22122415
Alignment:
| Q |
343 |
caggtggatttgataccgcgcatgctgcggcaag |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22122448 |
caggtggatttgataccgcgcatgctgcggcaag |
22122415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 343 - 376
Target Start/End: Original strand, 40512025 - 40512058
Alignment:
| Q |
343 |
caggtggatttgataccgcgcatgctgcggcaag |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40512025 |
caggtggatttgataccgcgcatgctgcggcaag |
40512058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University