View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_71 (Length: 298)
Name: NF19658_high_71
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 50490849 - 50491137
Alignment:
| Q |
1 |
gaggtgcatcagccagccaaatggcaatgttgggatggacatagataaattgcttgtaatctatctccaaactgcacttgttagctacaataaaagacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50490849 |
gaggtgcatcagccagccaaatggcaatgttgggatggacatagataaattgcttgtaatctatctccaaactgcacttgttagctacaataaaagacac |
50490948 |
T |
 |
| Q |
101 |
aataaattaggtggtgcaaagaagatgcttatgactgttgcagctacaaatcttgtagaaaatgtattacctgacaccatttcactaatcagacgcacat |
200 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50490949 |
aataaattaggtggt-caaagaagatacttatgactgttgcagctacaaatcttgtagaaaatgtattacctgacaccatttcacttatcagacgcacat |
50491047 |
T |
 |
| Q |
201 |
attcaaagtctccatgttcattctttggattgacgtaagagagtaagaaatccttgaacttcctggctatgaaacggcgcacttcatctc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50491048 |
attcaaagtctccatgttcattctttggattgacgtaagagagtaagaaatccttgaacttcctggctatgaaacggcgcacttcatctc |
50491137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University