View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_76 (Length: 291)
Name: NF19658_high_76
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 150946 - 151210
Alignment:
| Q |
1 |
agagagagacgagagtttgtttgtttgcataccgtaccatataatatatattggtgtgtgtgatcaatcgatcgatcgatcatccattattatacgttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
150946 |
agagagagacgagagtttgtttgtttgcataccgtactatataatatatattggtgtgtgtgatc----gatcgatcgatcatccattattatacgttca |
151041 |
T |
 |
| Q |
101 |
tcgttcaaagagggattcattaatggagtcattaactgaggaaaggattgagataagagatgatcacaaacagccgttactcatcagaagcagaattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151042 |
tcgttcaaagagggattcattaatggagtcattaacagaggaaaggattgagataagagatgatcacaaacagccgttactcatcagaagcagaattaat |
151141 |
T |
 |
| Q |
201 |
aactcttctcaactcgccatcgttggagccaatatttgccctattcagagtcttgattacgagtcagta |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151142 |
aactcttctcaactcgccatcgttggagccaatatttgccctattcagagtcttgattacgagtcagta |
151210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University