View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19658_high_84 (Length: 262)

Name: NF19658_high_84
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19658_high_84
NF19658_high_84
[»] chr5 (3 HSPs)
chr5 (13-247)||(6232591-6232828)
chr5 (31-112)||(6221953-6222034)
chr5 (193-246)||(6221810-6221863)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 6232828 - 6232591
Alignment:
13 gagaggaactccgatgattatgtcaccagaagcagtgaatgatagtgtttatgaatcgccagccgatatatgggctcttggttgcgccgtcgtggagatg 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||    
6232828 gagaggaactccgatgattatgtcaccagaagcagtgaatgatagtgtgtatgaatcgtcagccgatatatgggctcttggttgcgccgtcgtggagatg 6232729  T
113 attaccggagaac---ccgcatggaatgagtcagatatgttaatgttgacgattcgaattggggttggagaagaattgccaaagattccagacgaattat 209  Q
    |||||||||||||   ||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||    
6232728 attaccggagaacccgccgcatggaatgaatcagatatgttgatgttgacgattcgaattggtgttggagaagaattgccaaaaattccagaggaattat 6232629  T
210 cacaagaaggaaaagattttctagaaaagtgtttcatt 247  Q
    |||||||||||||||||||| |||||||||||||||||    
6232628 cacaagaaggaaaagattttttagaaaagtgtttcatt 6232591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 112
Target Start/End: Complemental strand, 6222034 - 6221953
Alignment:
31 tatgtcaccagaagcagtgaatgatagtgtttatgaatcgccagccgatatatgggctcttggttgcgccgtcgtggagatg 112  Q
    ||||||||||||||| ||||| || |||||||||||||| || || |||||||||||||||||||||||  | |||||||||    
6222034 tatgtcaccagaagcggtgaacgagagtgtttatgaatcaccggcagatatatgggctcttggttgcgctattgtggagatg 6221953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 193 - 246
Target Start/End: Complemental strand, 6221863 - 6221810
Alignment:
193 gattccagacgaattatcacaagaaggaaaagattttctagaaaagtgtttcat 246  Q
    ||||||||| |||||||||||||  |||||||||||||| ||||||||||||||    
6221863 gattccagatgaattatcacaagtcggaaaagattttctcgaaaagtgtttcat 6221810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University