View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_85 (Length: 259)
Name: NF19658_high_85
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 31464715 - 31464492
Alignment:
| Q |
19 |
caaaggtggatatagttattcattgtagaaaactcgaggaatctccgccagagagaattcactcccgaaaaagtgtcgggagtta----aatctattgat |
114 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
31464715 |
caaaggtggatatagttatgcatcgtagaaaattcgagggatctccgccggagagaattcactcccgaaaaagtgtcgggagtaataataatctattgat |
31464616 |
T |
 |
| Q |
115 |
gaagatgatcaaaaggaattgacattgtatctctatctattaaaaactttaaaacgtcgagaataatatatgtaaatcatatctcttgtaatttcttcat |
214 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31464615 |
gaagatgatcaaaagacattgatattatatctctatctattaaaaactttaaagcgtcgaaaataatatatgtaagtcatatctcttgtaatttcttcat |
31464516 |
T |
 |
| Q |
215 |
ttagtccatttattatagccgtta |
238 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
31464515 |
ttaatccatttattatagccgtta |
31464492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University