View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_89 (Length: 253)
Name: NF19658_high_89
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 41920638 - 41920861
Alignment:
| Q |
12 |
tcgaagaatatgtatttaaatgtataccttttttaactactactgtgtaacatgctgtacaaatacataagccaa-tttccctttaaatacaagaaactt |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41920638 |
tcgaataatatgtatttaaatgtatacctttttcaactactactgtgtaacatgctgtacaaatacataagccaaatttccctttaaatacaagaaactt |
41920737 |
T |
|
| Q |
111 |
gttatgcaagtaaaactttgttaacttgattgtgttttctacatgtcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41920738 |
gttatgcaagtaaaactttgttaacttgattgtgttttctacatgtcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctct |
41920837 |
T |
|
| Q |
211 |
gcatagagcaaaggcaactgttat |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41920838 |
gcatagagcaaaggcaactgttat |
41920861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 228
Target Start/End: Complemental strand, 26829966 - 26829895
Alignment:
| Q |
157 |
caggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaac |
228 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||| |||||| ||||||||| ||| || |||||||||| |
|
|
| T |
26829966 |
caggtcattccatttacttgtcttttggattttattcgagaataccatgtctcttcatcgaacaaaggcaac |
26829895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University