View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_high_96 (Length: 241)
Name: NF19658_high_96
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_high_96 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 41986303 - 41986509
Alignment:
| Q |
17 |
cataggggcaaggatactcacatgggcggaggggatggaagagttgtgtttcgccacatgaattttgggtaattctaatcaaccagggacggagattttg |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986303 |
cataagggcaaggatactcacatgggcggagtggatggaagagttgtgtttccccacatgaattttgggtaattctaatcaaccagggacggagattttg |
41986402 |
T |
|
| Q |
117 |
ttgttgcgttggtggtttgatgagtaagagactgtgttttgagaggaaataggatgatgatggacagtgaaactcaaaatgttttatcttgaagggcact |
216 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986403 |
ttgttgtggtggtggtttgatgagtaagagactgtgttttgagaggaaataggatgatgatggacagtgaaactcaaaatgttttatcttgaagggcact |
41986502 |
T |
|
| Q |
217 |
aaattag |
223 |
Q |
| |
|
||||||| |
|
|
| T |
41986503 |
aaattag |
41986509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Complemental strand, 44688249 - 44688182
Alignment:
| Q |
43 |
cggaggggatggaagagttgtgtttcgccacatgaattttgggtaattctaatcaaccagggacggag |
110 |
Q |
| |
|
||||| || ||||||||||||||||| || | ||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
44688249 |
cggagtgggtggaagagttgtgtttctccgcgtgagtttttggtaattctaatcaaccaaggacggag |
44688182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University