View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19658_low_105 (Length: 233)

Name: NF19658_low_105
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19658_low_105
NF19658_low_105
[»] chr8 (1 HSPs)
chr8 (12-218)||(37302467-37302673)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 37302673 - 37302467
Alignment:
12 aagcatagggtaatggtgtgaagctaagaaaggggacaaaaaaggagcgatgggtccaaggttaattattttcttaataagacgggttggggtatctttc 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37302673 aagcttagggtaatggtgtgaagctaagaaaggggacaaaaaaggagcgatgggtccaaggttaattattttcttaataagacgggttggggtatctttc 37302574  T
112 tttttgttannnnnnncctcttagagacagagatggagtgagcatttagtgaggttgccggaggatatatgatcaattaaaagccaacttgacagatggg 211  Q
    |||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37302573 tttttgttatttttttcctcttagagacagagatggagtgagcatttagtgaggttgccggaggatatatgatcaattaaaagccaacttgacagatggg 37302474  T
212 aaaaggt 218  Q
    |||||||    
37302473 aaaaggt 37302467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University