View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_106 (Length: 232)
Name: NF19658_low_106
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_106 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 8292986 - 8293205
Alignment:
| Q |
1 |
ttacatgggaaataatcttctgtatatgtgtactagaaactgcaaatacaagaacatgcaattcagccgttgnnnnnnnn-attcaaaataaccgaaaat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
8292986 |
ttacatgggaaataatcttctgtatatgtgtactagaaactgtaaatacaagaacatgcaattcagccgttgtttttttttattcataataaccgaaaat |
8293085 |
T |
|
| Q |
100 |
ttcacaaacaagaattaattggttacgtacatatgtgcaaagaaaaatttgttatacatgaatttcaatgaaggtgatccatgtatataaatcaatggga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293086 |
ttcacaaacaagaattaattggttacgtacatatgtgcaaagaaaaatttgttatacatgaa-ttcaatgaaggtgatccatgtatataaatcaatggga |
8293184 |
T |
|
| Q |
200 |
aaagtctggttgcaaattctg |
220 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
8293185 |
aaagtctagttgcaaattctg |
8293205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University