View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_109 (Length: 216)
Name: NF19658_low_109
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_109 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 26520179 - 26519971
Alignment:
| Q |
12 |
atgaagtgttcgtgctacataact----tttaagggatgtaggtaagtccacaaaagtcaaaactaaattatcaagattaggattttaatatgtaacact |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26520179 |
atgaagtgttcgtgctacataactaacttttaagggatgtagataagtccataaaagtcaaaactaaattatcaagataaggattttaatatgtaacact |
26520080 |
T |
 |
| Q |
108 |
ttctttcttataattcaattgacattttatttcactatcaaaatagtatatttattaactacaacagacccagctttctccatataagaatacgaaactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26520079 |
ttctttcttataattcaattgacattttatttcactatcaaaatagtatatttattaacttcaacagacccagctttctccatataagaatacgaaactt |
26519980 |
T |
 |
| Q |
208 |
gagttatac |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
26519979 |
gagttatac |
26519971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University