View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_110 (Length: 214)
Name: NF19658_low_110
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_110 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 42881608 - 42881801
Alignment:
| Q |
1 |
acagtgtgctttaggggtgtttttgcagctg-tgcagtggtgctgtggtgttttgtcagcgtatgagcctttcctgggttcttgctgttgctgctgttgt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42881608 |
acagtgtgctttaggggtgtttttgcagctgctgcattggtgctgtggtgttttgtcagcgtgtgagccttttctgggtttttgctgttgctgctgttgt |
42881707 |
T |
|
| Q |
100 |
gtcttgcaggtctgtttgctgctaggcgctttgggtagtggctgctgtcatgatagcagagttgctgttctgttcagctgctactggtggggat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42881708 |
gtcttgcaggtctgtttgctgctaggcgctttgggtagtggctgctgtcatgatagcagagttgctgttctgttcagctgctactggtggggat |
42881801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University