View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_112 (Length: 211)
Name: NF19658_low_112
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_112 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 36 - 193
Target Start/End: Complemental strand, 9081548 - 9081390
Alignment:
| Q |
36 |
ttattctataaaatttgatacattaatttaatagattattcactaac-----attgggtctgatcagatcacaggtttccttaatttacaagttgcctca |
130 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||| ||| | ||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9081548 |
ttattctttaaaatttggtacattaatttaatagattattcactaatgtattattcgatctaatcagatcaaaggtttccttaatttacaagttgcctca |
9081449 |
T |
|
| Q |
131 |
catattgtgtgttttgcagacaaaatagagaggaatgtagggattaaggaaggttcttgccat |
193 |
Q |
| |
|
||| ||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9081448 |
cat----tgtgttttgaagaaaaaatagagaggaatgtagggattagagaaggttcttgccat |
9081390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 42
Target Start/End: Complemental strand, 9081616 - 9081579
Alignment:
| Q |
5 |
ttgatgaatttgttgactcaaatgatagattttattct |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9081616 |
ttgatgaatttgttgactcaaatgatagattttattct |
9081579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University