View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_53 (Length: 365)
Name: NF19658_low_53
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 8e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 30489904 - 30489731
Alignment:
| Q |
1 |
tgttgcttgtttgctacttatgtggcactccaccttatggtcaatttggaatgtttgaaagatttctaagactcccaaaataatatgtagtatgttcgag |
100 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
30489904 |
tgttgcttgtttgctactgatttggcactccaccttatggtcaatttggaatgtttgaaagatttctaagactcccaaaagaatatggagtatgttcgag |
30489805 |
T |
 |
| Q |
101 |
gttgttgacacgataaaaatataggaaatgttaaccggtgctcggggcgctggttaagggccttaaatagttaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
30489804 |
gttgttgacacgataaaaatataggaaatattaaccggtgctcggggcgctggttaaaggccttaaataattaa |
30489731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University