View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19658_low_55 (Length: 353)

Name: NF19658_low_55
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19658_low_55
NF19658_low_55
[»] chr7 (2 HSPs)
chr7 (238-334)||(45918554-45918650)
chr7 (197-228)||(45918687-45918718)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 238 - 334
Target Start/End: Complemental strand, 45918650 - 45918554
Alignment:
238 ccaacttcagtgaagtaaggaagtacaccacccaacttcgagaaattatgcattctttctgcaactaatgcaccactcaatgcaacacagcaaatac 334  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
45918650 ccaacttcagtgaagtaaggaagtacaccacccaacttcgagaaattatgcattctttctgcaactaatgcaccactcaatgcaacacaacaaatac 45918554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 197 - 228
Target Start/End: Complemental strand, 45918718 - 45918687
Alignment:
197 atcacactatacgcaccatgtggaaagcattg 228  Q
    ||||||||||||||||||||||||||||||||    
45918718 atcacactatacgcaccatgtggaaagcattg 45918687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University