View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_61 (Length: 326)
Name: NF19658_low_61
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 2 - 320
Target Start/End: Original strand, 48965074 - 48965392
Alignment:
| Q |
2 |
ctgcaatagaaatgatgcataagtactttgttggccatgtcgacacgtccaccgttccaacaaaagttgagcacaattcaccaccatctacacaggcaca |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965074 |
ctgcaatagaaatgatgcatgagtactttgttggccatgtcgacacgtccaccgttccaacaaaagttgagcacaattcaccaccatctacacaggcaca |
48965173 |
T |
 |
| Q |
102 |
aagtgttagggatcaatcatcaggatttattacaaagacattgcaattcctgttgcctctactcatattggcctttgcgtttgctatgcagcactacgga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48965174 |
aagtgttagggatcaatcatcaggatttgttacaaagacattgcaattcctgttgcctctactcatattggcctttgcgtatgctatgcagcactacgga |
48965273 |
T |
 |
| Q |
202 |
aaaaagaaacaagtcagcgactcataaaacctgaacttggagcaacaattattttgtgcatgaatcaaatgcattactctgcccaatacaatgcagggct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48965274 |
aaaaagaaacaagtcagcgactcataaaacctgaacttgaagcaacaattattttgtgcatgaatcaaattcattactctgcccaatacaatgcagggct |
48965373 |
T |
 |
| Q |
302 |
cttgatgtatgatgatgtc |
320 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
48965374 |
cttgatgtactatgatgtc |
48965392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University