View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_62 (Length: 320)
Name: NF19658_low_62
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 155 - 268
Target Start/End: Complemental strand, 44669241 - 44669128
Alignment:
| Q |
155 |
cgttaactctgcattggtatcaccgttgccgcgcatactgggttatcaaatgtgcaaacaatcaaaccattagtcctctttacaacaacgactttaattt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44669241 |
cgttaactctgcattggtatcaccgttgccgcgcatattgggttatcaaatgtacaaacaatcaaaccattagtcctctttacaacaacgactttaattt |
44669142 |
T |
|
| Q |
255 |
aataaaaataagaa |
268 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
44669141 |
aataaaaatgagaa |
44669128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 44669345 - 44669234
Alignment:
| Q |
17 |
caattcttggcctctatttggttttgcggcaagttttttgtgttacttcaaaacgaaagcaatattttcacatagaagcttcattttctagcttctggaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44669345 |
caattcttggcctctatttggttttgcggcaagttttttgtgttacttcaaaacgaaagcaatattttcacatagaagcttcattttctagcttctaaaa |
44669246 |
T |
|
| Q |
117 |
atcacgttaact |
128 |
Q |
| |
|
||| |||||||| |
|
|
| T |
44669245 |
atcgcgttaact |
44669234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 91
Target Start/End: Complemental strand, 43496975 - 43496931
Alignment:
| Q |
47 |
aagttttttgtgttacttcaaaacgaaagcaatattttcacatag |
91 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
43496975 |
aagttttttgcgttacttcaaaattaaagcaatattttcacatag |
43496931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University